Teams identifies cell entry mechanism of SARS-CoV-2 and therapeutic target for COVID-19 hkbaptistu NatureComms
. Our study reveals that MT1-MMP could be the potential druggable target for these new variants as inhibition of MT1-MMP activity by either pharmacological antagonism or genetic knockdown effectively restricted the cell entry of SARS-CoV-2 wild-type virus and its variants of concern in human primary cells and organoids. Identification of new proteases involved in ACE2 processing will certainly provide potential opportunities to target proteases as an antiviral strategy.
pCMV-GFP-ACE2 and pCMV-FLAG-MMP14 plasmids were purchased from Sino Biological . pCMV-FLAG-MMP14 , the primers used for plasmid construction were as follows: F: GGGGTACCATGTCTCCCGCCCCAAG; R: TCTAGACTCGAGTTTACTTATCGT; F1: TGGTGGCTGTGCACGCGCTGGGCCATGCCCT; R1: AGGGCATGGCCCAGCGCGTGCACAGCCACCA. PCR amplification was performed using the pCMV-FLAG-MMP14 plasmid as a template. The sequences of the gene-specific primers for constructing ACE2 point mutations were shown in Supplementary Table.
. Cardiac organoids were disassembled using TrypLE express upon reaching confluence, and infected with shlentivirus for 24 h. Cardiac organoids were subsequently selected with Puromycin for one week.Cells grown on six-well plates were transfected with 1μg of the expression vector using Lipofectamine 3000 . 48 h after transfection, cells were washed twice with PBS and incubated with serum-free DMEM at 37 °C for 12 h.
Deutschland Neuesten Nachrichten, Deutschland Schlagzeilen
Similar News:Sie können auch ähnliche Nachrichten wie diese lesen, die wir aus anderen Nachrichtenquellen gesammelt haben.
XBB/XBB.1.5 subvariant of SARS-CoV-2 shows increased vaccine sensitivityThe study, currently available on the medRxiv* preprint server, indicates that omicron subvariant XBB/XBB.1.5 is more sensitive to vaccine-induced immunity than other co-circulating SARS-CoV-2 variants.
Weiterlesen »
Pleasure Beach pass that gets you free entry to parks across EuropeFor less than £150 you can gain free access to five different parks in Germany, Sweden, Spain and more
Weiterlesen »
Vladimir Putin visits occupied Ukrainian city of Mariupol, Russian state media reportsVladimir Putin has visited the occupied Ukrainian city of Mariupol, according to Russian media reports.
Weiterlesen »
Ukraine war: Putin pays visit to war-damaged Mariupol, state media reportsPresident Putin toured Mariupol, a Ukrainian city devastated by Russian shelling, the Kremlin says.
Weiterlesen »
The Cheshire village that 'voted' to be part of WalesThe tongue-in-cheek poll attracted nation-wide media attention
Weiterlesen »
Chelsea and Newcastle United - I'm intrigued by this very different media coverageChelsea and Newcastle United - I'm intrigued by this very different media coverage nufc
Weiterlesen »